Review



recombinant proteins e64d tocris  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Tocris recombinant proteins e64d tocris
    Recombinant Proteins E64d Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+e64d+tocris/E+64d/pm40811064-200-103-106
    Average 94 stars, based on 49 article reviews
    recombinant proteins e64d tocris - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Virus:

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1 ..

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..

    Recombinant:

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1 ..

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..

    Transfection:

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1 ..

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..

    SYBR Green Assay:

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1 ..

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..

    Polymerase Chain Reaction:

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1 ..

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..

    Western Blot:

    Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems Cat#AF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..



    Similar Products

    recombinant proteins e64d tocris  (Tocris)
    94
    Tocris recombinant proteins e64d tocris
    Recombinant Proteins E64d Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+proteins+e64d+tocris/E+64d/pm40811064-200-103-106
    Average 94 stars, based on 1 article reviews
    recombinant proteins e64d tocris - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results